Table 1

Primers and probes for genotyping of KLK3 and VDR SNPs
Gen rs Varian Primer probe
KLK 2725839 A/G Forward: TCCTCAACCTTCCCTATTTCTG
Reverse: GTGAGGGAAAGGGAGAAGATGA
FAM-CATGGTCCATTGGCCACAAGAC-TAMRA
HEX-CATGGTCCACTTGGCCACAGACA--TAMRA
VDR 731236 T/C Forward: CGTGCCCACAGATCGTCC
Reverse: TGTACGTCTGCAGTGTGTTGGA
FAM-CCGCGCTGATTGAGGCCATC-TAMRA
HEX-CGCGCTGATCGAGGCCATC-TAMRA

KLK: Kallikren 3; VDR: Vitamin D receptor; SNPs: single nucleotide polymorphisms.

Hu et al.

Hu et al. Diagnostic Pathology 2014 9:84   doi:10.1186/1746-1596-9-84

Open Data