Table 2

Q-MSP primer and TaqMan probe sequences used in this study
Genes Forward primer sequences (5′ → 3′) Probe sequence Reverse primer sequence (5′ → 3′)
CALCA GTTTTGGAAGTATGAGGGTGACG 6FAM-ATTCCGCCAATACACAACAACCAATAAACG-TAMRA TTCCCGCCGCTATAAATCG
DAPK1 GGATAGTCGGATCGAGTTAACGTC 6FAM-TTCGGTAATTCGTAGCGGTAGGGTTTGG-TAMRA CCCTCCCAAACGCCGA
TIMP3 GCGTCGGAGGTTAAGGTTGTT 6FAM-AACTCGCTCGCCCGCCGAA-TAMRA CTCTCCAAAATTACCGTACGCG
RAR-beta GGGATTAGAATTTTTTATGCGAGTTGT 6FAM-TGTCGAGAACGCGAGCGATTCG-TAMRA TACCCCGACGATACCCAAAC
RASSF1A GCGTTGAAGTCGGGGTTC 6FAM-ACAAACGCGAACCGAACGAAACCA-TAMRA CCCGTACTTCGCTAACTTTAAACG
β-actin TGGTGATGGAGGAGGTTTAGTAAGT 6FAM-ACCACCACCCAACACACAATAACAAACACA-TAMR AAACCAATAAAACCTACTCCTCCCTTAA

Zhang et al.

Zhang et al. Diagnostic Pathology 2014 9:45   doi:10.1186/1746-1596-9-45

Open Data