Table 2

The primer and TaqMan probe sequences used in this study
Genes Forward primer sequence Probe sequence Reverse primer sequence Amplification
(5′ → 3′) (5′ → 3′) (5′ → 3′) Efficiency (%)
MT-ND1 CCCCTAAAACCCGCCACATC 6FAM-ACCCTCTACATCACCGCCCCGACC-TAMRA GTAGAAGAGCGATGGTGAGAGC 94.6
β-actin TCACCCACACTGTGCCCATCTACGA 6FAM-ATGCCCTCCCCCATGCCATCC-TAMRA TCGGTGAGGATCTTCATGAGGTA 95.2

Dang et al.

Dang et al. Diagnostic Pathology 2014 9:28   doi:10.1186/1746-1596-9-28

Open Data