Table 1

Sequences of primers and product size used in real time RT-PCR
Gene Forward Backward size
E-cadherin AGTCACGCTGAATACAGTGG CATTTTCTGGGCAGCTGATG 161
N-cadherin CAGTGCAGTCTTATCGAAGG GAAAGCTTCTCACGGCATAC 158
β-catenin AATGGCAGTGCGTTTAGCTG ATAGCACCTTCAGCACTCTG 233
S100A4 CACAAGTACTCGGGCAAAGA TACACATCATGGCGATGCAG 211
GAPDH TGAGAACGGGAAGCTTGTCA GGAAGGCCATGCCAGTGA 258

Lee et al.

Lee et al. Diagnostic Pathology 2013 8:99   doi:10.1186/1746-1596-8-99

Open Data