Table 1

Primers used in this study
Gene Forward primers (5′-3′) Reverse primers (5′-3′)
PGRN gatcctgcgagaaggaagtg ggccagtaatgcaggct
IL-6 aggagacttgcctggtgaaa gtactgggaatcggtacg
PR3 ccatgcggcatagctataatt gacctttattggcgtacttc
TNFR accaagtgccacaaaggaac gcggtaccatattaaccgg
GAPDH cagaacatcatccctgcctctac ggcattccggtcgtgggc

Qiu et al.

Qiu et al. Diagnostic Pathology 2013 8:88   doi:10.1186/1746-1596-8-88

Open Data