Table 1

Primers for MSP
Gene Forward primer 5-3 Reverse primer 5-3 Tm,°C
GATA4-M GTATAGTTTCGTAGTTTGCGTTTAGC AACTCGCGACTCGAATCCCCG 62
GATA4-U TTTGTATAGTTTTGTAGTTTGTGTTTAGT CCCAACTCACAACTCAAATCCCCA 62
DcR1-M TTACGCGTACGAATTTAGTTAAC TCAACGACCGACCGAAACG 60
DcR1-U GAATTTTTTTATGTGTATGAATTTAGTTAAT CCATCAAACAACCAAAACA 60

M – methylated, U – unmethylated, Tm – melting temperature.

Vaitkienė et al.

Vaitkienė et al. Diagnostic Pathology 2013 8:7   doi:10.1186/1746-1596-8-7

Open Data