Table 2

Sequences of oligodeoxyribonucleotides
Name Sequence (5′→3′)1 Position
19 F GCCAGTTAACGTCTTCCTTCTCTC Intron 18
19R YGAGCAGGGTCTAGAGCAGAGCA Intron 19
21 F CGGATGCAGAGCTTCTTCCCATG Intron 20
21R CTAGTGGGAAGGCAGCCTGGTC Intron 21
CLMP1 +T+T+A+A+GA+GA+A+G+C+AA+C+A+T+CT-C3 Exon 19
CLMP2 +T+G+G+G+C+T+GGCA-C3 Exon 21

1Other than the bases A, T, C and G, the oligos are described by a Y for mixed T and C; the positions of the LNA nucleotides (+ before the LNA) in the clamps (CLMP1 and CLMP2); and the C3 spacer (-C3) on the 3′ terminus of the clamps.

Xiong et al.

Xiong et al. Diagnostic Pathology 2013 8:27   doi:10.1186/1746-1596-8-27

Open Data