Table 1

List of all primers used and conditions of PCR amplification
Primer Sequence (5′-3′) Product size (bp)
M F CGAAGAGGTTGCGGGCGGTATTAGCG 130
R TACTCCAAAAACGTCCGATAACCG
U F TGGTGAAGAGGTTGTGGGTGGTATTAGTG 134
R ACCTACTCCAAAAACATCCAATAACCA
RT-PCR
EDNRB-F GAAAGCCTCCGTGGGAATC 86
EDNRB-R ACAGCTCGATATCTGTCAATACTCAGA
GAPDH-F CCATGGAGAAGGCTGGGG 194
GAPDH-R CAAAGTTGTCATGGATGACC

Chen et al.

Chen et al. Diagnostic Pathology 2013 8:199   doi:10.1186/1746-1596-8-199

Open Data