Table 2

Polymerase chain reaction primers of SNP
SNP PCR primer Sequence Extension primer Sequence
Rs662 1st-Primer ACGTTGGATGGATCACTATTTTCTTGACCC 1st-Primer TGTTCTTGACCCCTACTTACA
2nd-primer ACGTTGGATGTAGACAACATACGACCACGC 2nd-primer TGTTCTTGACCCCTACTTACG

Wang et al.

Wang et al. Diagnostic Pathology 2013 8:186   doi:10.1186/1746-1596-8-186

Open Data