Table 2

The primer and TaqMan probe sequences used in this study
Genes Forward primer sequence (5′→3′) Probe sequence (5′→3′) Reverse primer sequence (5′→3′) Amplification efficiency (%)
MT-ND1 CCCCTAAAACCCGCCACATC 6FAM-ACCCTCTACATCACCGCCCCGACC-TAMRA GTAGAAGAGCGATGGTGAGAGC 93.6
β-actin TCACCCACACTGTGCCCATCTACGA 6FAM-ATGCCCTCCCCCATGCCATCC-TAMRA TCGGTGAGGATCTTCATGAGGTA 95.7

Zhang et al.

Zhang et al. Diagnostic Pathology 2013 8:173   doi:10.1186/1746-1596-8-173

Open Data