Table 2

Polymerase chain reaction primers of selected SNPs
Single nucleotide polymorphism PCR primer Sequence Extension primer Sequence
rs11178 1st-primer ACGTTGGATGATAGTTTCTACCAGGCACAC 1st-primer AGGCCCTTTGCAGGAC
2nd-primer ACGTTGGATGAGACCTGGTTCCCACTGAG 2nd-primer AGGCCCTTTGCAGGAT
rs2227631 1st-primer ACGTTGGATGAAGGAAACAGGAGACCAACG 1st-primer gcaTAGCGGGCAGCTCGAA
2nd-primer ACGTTGGATGAGGATAAAGGACAAGCTGCC 2nd-primer gcaTAGCGGGCAGCTCGAG

Zhang et al.

Zhang et al. Diagnostic Pathology 2013 8:169   doi:10.1186/1746-1596-8-169

Open Data