Table 1

Primers for amplification of virulence associated genes, Listeria spp. and serotypes of L. monocytogenes
Primer name Primer sequence (5′-3′) Target Size of product (bp) References
Lis1B TTATACGCGACCGAAGCCAAC L. innocua 870 [26]
Ino2 ACTAGCACTCCAGTTGTTAAAC
Lis1B TTATACGCGACCGAAGCCAAC L. 660 [26]
MonoA CAAACTGCTAACACAGCTACT monocytogenes
Lis1B TTATACGCGACCGAAGCCAAC L. ivanovii 1100 [26]
Iva1 CTACTCAAGCGCAAGCGGCAC
Lis1B TTATACGCGACCGAAGCCAAC L. seeligeri 1100 [26]
Sel1 TACACAAGCGGCTCCTGCTCAAC
Lis1B TTATACGCGACCGAAGCCAAC L. welshimeri 1050 [26]
Wel1 CCCTACTGCTCCAAAAGCAGCG
Lis1B TTATACGCGACCGAAGCCAAC L. grayi 480 [26]
MuraI GTGATTTCTGCTTGCCATAG
prsF GCTGAAGAGATTGCGAAAGAAG All L. monocytogenes serovares 370 [27]
prsR CAAAGAAACCTTGGATTTGCGG
lmo0737F AGGGCTTCAAGGACTTACCC L. monocytogenes serovar1/2a 691 [27]
lmo0737R ACGATTTCTGCTTGCCATTC
ORF2819F AGCAAAATGCCAAAACTCGT L. monocytogenes serovar1/2b 471 [27]
ORF2819R CATCACTAAAGCCTCCCATTG
ORF2110F AGTGGACAATTGATTGGTGAA L. monocytogenes serovar 4b 597 [27]
ORF2110R CATCCATCCCTTACTTTGGAC
plc A-F CTGCTTGAGCGTTCATGTCTCCATCCCCC plcA gene 1484 [28]
plc A-R CATGGGTTTCACTCTCCTTCTAC
prf A-F CTGTTGGAGCTCTTCTTGGTGAAGCAATCG prfA gene 1060 [28]
prf A-R AGCAACCTCGGTACCATATACTAACTC
act A-F CGCCGCGGAAATTAAAAAAAGA actA gene 839 [29]
act A-R ACGAAGGAACCGGGCTGCTAG
hly A-F GCAGTTGCAAGCGCTTGGAGTGAA hlyA gene 456 [30]
hly A-R GCAACGTATCCTCCAGAGTGATCG
Iap-F ACAAGCTGCACCTGTTGCAG Iap gene 131 [31]
Iap-R TGACAGCGTGTGTAGTAGCA

Momtaz and Yadollahi

Momtaz and Yadollahi Diagnostic Pathology 2013 8:149   doi:10.1186/1746-1596-8-149

Open Data