Table 1

RT-PCR probes
Names Probes Sequence
STAT5 Forward Primer 5’ GCTGGAAGCCTTGCTGAT 3’
Reverse Primer 5’ TCCTCAAACGTCTGGTTGATC 3’
Probe 5’ FAM-TGTCCCAGAAACACCTC–TAMRA 3’
Bcl2 Forward Primer 5’ CATGTGTGTGGAGAGCGTCAA 3’
Reverse Primer 5’ GCCGGTTCAGGTACTCAGTCAT 3’
Probe 5’ FAM-TGGACAACATCGCCCTGT–TAMRA 3’
Cyclin-D1 Forward Primer 5’ GTGGCCTCTAAGATGAAGGA 3’
Reverse Primer 5’ GGTGTAGATGCACAGCTTCT 3’
Probe 5’ FAM-ACCATCCCCCTGACGGC–TAMRA 3’
GAPDH Forward Primer 5’ GGTGGTCTCCTCTGACTTCAACA 3’
Reverse Primer 5’ CCAAATTCGTTGTCATACCAGGAAATG 3’
Probe 5’FAM-CGACACCCACTCCTCCACCTTTGACGC–TAMRA 3’

The primers and probes were designed according to the software of Primer Express 3.0(ABI Corp), which all were synthetized by Shanghai bioengineering company, China.

Yang et al.

Yang et al. Diagnostic Pathology 2013 8:132   doi:10.1186/1746-1596-8-132

Open Data