Table 2

Sequence of p rimers and enzymes used in FLT3 reactions
Primers Sequence Enzyme
FLT3-ITD GCAATTTAGGTATGAAAGCCAGC -
CTTTCAGCATTTTGACGGCAACC
FLT3-TKD CCGCCAGGAACGTGCTTG EcoRV
GCAGCCTCACATTGCCCC

De Mello et al.

De Mello et al. Diagnostic Pathology 2012 7:75   doi:10.1186/1746-1596-7-75

Open Data