Table 1

Sequences of primers and conditions used bisulfite PCR
Primers Sequences Temperature (°C) Enzyme
CDKN2B GGAGTTTAAGGGGGTGGG 58 BstUI
CCTAAATTACTTCTAAAAAAAAAC
CDKN2A U TTATTAAGAGGGTGGGGTGGATTGT 60 -
CAACCCCAAACCACAACCATAA
CDKN2A M TTATTAGAGGGTGGGGCGGATCGC 60 -
AGGGGATGTAGTGAAATTGGGGTTT
TP73 U AGGGGATGTAGTGAAATTGGGGTTT 60 -
ATCACAACCCCAAACATCAACATCCA
TP73 M GGACGTAGCGAAATCGGGGTTC 60 -
ACCCCGAACATCGACGTCCG

De Mello et al.

De Mello et al. Diagnostic Pathology 2012 7:75   doi:10.1186/1746-1596-7-75

Open Data