Table 1

Nucleotide primer sequences used for real-time quantitative PCR
Target genes Nucleotide sequence Orientation Amplicon length Accession No.
Bak

5— CCCAGGACACAGAGGAGGTTT—3

5— GCCTCCTGTTCCTGCTGATG—3

Sense

Antisense

65 bp NM001188
Bcl-xl

5— TGCGTGGAAAGCGTAGACAA—3

5—ATTCAGGTAAGTGGCCATCCAA—3

Sense

Antisense

75 bp NM138578
Mcl-1

5— AGGCTGGGATGGGTTTGTG—3

5—CACATTCCTGATGCCACCTTCT—3

Sense

Antisense

65 bp NM021960
GAPDH

5- AACAGCCTCAAGATCATCAGCA-3

5- CATGAGTCCTTCCACGATACCA-3

Sense

Antisense

102 bp M33197

Zhang et al.

Zhang et al. Diagnostic Pathology 2012 7:65   doi:10.1186/1746-1596-7-65

Open Data