Table 2

Targeted Mutations and Pyrosequencing dispensing order for EGFR, KRAS and BRAF mutations
Targeted Mutations Pyrosequencing Dispensing Orders
EGFR exon 18, codon 719: CATGTCACTCGTG
EGFR exon 19 deletions CTATCACTGTCAGCTCGATCGTCATCGTCACGC

EGFR exon 20,

Codon 768 and insertions

GCAGTACGTGTCGTGTACGTGACCACACTG
EGFR exon 20, Codon 790 GATTCATCTG
EGFR exon 21 ACGTGTCACATGTC
KRAS codon 12 & 13 ACTGTACGTGATCGTAGCAAGAG
KRAS codon 61 (reverse sequencing) GCTCGATACGACCT
BRAF codon 600 (reverse sequencing) TCGTATCTGTAG

Shen and Qin

Shen and Qin Diagnostic Pathology 2012 7:56   doi:10.1186/1746-1596-7-56

Open Data