Table 1

Targeted Mutations and Sequences for EGFR, KRAS and BRAF mutations
Targeted Mutations Targeted Sequences
EGFR exon 18, codon 719 DSCTCCGGTGC
EGFR exon 19 deletions TATCAA[GGAATTAAGAGAAGC]AACATCTCCGAAAGCCA
EGFR exon 20, Codon 768 CAGCGTGGACAACCCCCACG
EGFR exon 20, Codon 790 ATCAYG
EGFR exon 21 CKGGCCAAACDGCTGGGT
KRAS codon 12 & 13 NNTGRCGTAGGC
KRAS codon 61 (reverse sequencing) CTCDTGACCTG
BRAF codon 600 (reverse sequencing) CWCTGTAG

Note: “D” could be A, T, U, or G (but not C); “S” could be C or G; “Y” could be C, T or U; “N” could any base; “R” could be A or G; “W”: T, U, or A. “[GGAATTAAGAGAAGC]” indicates deletion of the sequence.

Shen and Qin

Shen and Qin Diagnostic Pathology 2012 7:56   doi:10.1186/1746-1596-7-56

Open Data