Table 1

Primers used for real-time PCR
Primer 5′-3′ sequence Size of PCR (bp)
Survivin forward TCATAGAGCTGCAGGGTGGATTGT 114
reverse AGTAGGGTCCACAGCAGTGTTTGA
VEGF-C forward AACCTCCATGTGTGTCCGTC 156
reverse TGGCAAAACTGATTGTTACTGG
GAPDH forward ACAGTCCATGCCATCACTGCC 266
reverse GCCTGCTTCACCACCTTCTTG

Cai et al.

Cai et al. Diagnostic Pathology 2012 7:52   doi:10.1186/1746-1596-7-52

Open Data