Table 1

Specification of Primers used in RT-PCR and qRT-PCR Experiments

S. No.

Target Gene

Primer Name

Primer Sequence 5'-----------------3'


1)

EBV encoded RNA 1 (EBER1)

EB1 (Forward)

EB1 (Reverse)

5'- AGGACCTACGCTGCCCTAGA -3'

5'- AAAACATGCGGACCACCAGCTGG -3'


2)

EBV encoded RNA 2 (EBER2)

EB2 (Forward)

EB2 (Reverse)

5'- AGGACAGCCGTTGCCCTAGTG -3'

5'- TAGCGGACAAGCCGAATACCCT -3'


3)

Interleukin 10 (IL10), mRNA

IL-10 (Forward)

IL-10 (Reverse)

5'- ATGCACAGCTCAGCACTGCTCTG -3'

5'- GGAAGAAATCGATGACAGCGCCG -3'


4)

Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH), mRNA

GAP (Forward)

GAP (Reverse)

5'- CAAGGTCATCCATGACAACTTTG -3'

5'- GTCCACCACCCTGTTGCTGTAG -3'


Sheikh and Qadri Diagnostic Pathology 2011 6:70   doi:10.1186/1746-1596-6-70

Open Data