Table 2

Quantitative methylation-specific PCR primer and TaqMan probe sequences used in the present study

Genes

Forward primer sequence (5'→3')

Probe sequence (5'→3')

Reverse primer sequence (5'→3')


CALCA

GTTTTGGAAGTATGAGGGTGACG

6FAM-ATTCCGCCAATACACAACAACCAATAAACG-TAMRA

TTCCCGCCGCTATAAATCG


CDH1

AATTTTAGGTTAGAGGGTTATCGCGT

6FAM-CGCCCACCCGACCTCGCAT-TAMRA

TCCCCAAAACGAAACTAACGAC


DAPK1

GGATAGTCGGATCGAGTTAACGTC

6FAM-TTCGGTAATTCGTAGCGGTAGGGTTTGG-TAMRA

CCCTCCCAAACGCCGA


IRX2

GCGGGTCGTTTAGGTTAGTATTCG

6FAM-CCCTCCATCCACGCCCGACCGAAA-TAMRA

CGCCGAACAACGAACAAAACG


TIMP3

GCGTCGGAGGTTAAGGTTGTT

6FAM-AACTCGCTCGCCCGCCGAA-TAMRA

CTCTCCAAAATTACCGTACGCG


PAX6

ATATAGGACGGCGGTTTAGGTTG

6FAM-CCCAAAATCCGACCGACTCCAACCCCTA-TAMRA

TTCCGACCGAACGAAAACCTAC


β-Actin

TGGTGATGGAGGAGGTTTAGTAAGT

6FAM-ACCACCACCCAACACACAATAACAAACACA-TAMRA

AACCAATAAAACCTACTCCTCCCTTAA


Ji et al. Diagnostic Pathology 2011 6:48   doi:10.1186/1746-1596-6-48

Open Data