Table 2

Primer details: Sequence, annealing temperature (AT), and amplicon size (AS) of target sequence

Target gene

Sequence (FP; 5' to 3')

AT [°C]

AS [bp]


Sequence (RP; 5' to 3')


GAPDH

AATGGTAAGGTCGGTGTGTGAA

60

262


GAAGATGGTGATGGGCTTCC


GAPDH-3' UTR

ACAGGGTGGTGGACCTCATG

60

102


GTTGGGATAGGGCCTCTCTTG


PBGD

TGCACGATCCTGAAACTCTG

60

163


TGCATGCTATCTGAGCCATC


28S

TCATCAGACCCCAGAAAAGG

60

102


GATTCGGCAGGTGAGTTGTT


18S

GCAATTATTCCCCATGAACG

60

123

GGCCTCACTAAACCATCCAA


Muyal et al. Diagnostic Pathology 2009 4:9   doi:10.1186/1746-1596-4-9

Open Data