Table 1

H1 and H2 primers for VPH 16 intron E6

Subtype HPV

primers secuence (5'-3')

product PCR


HPV 16

H1: ATT AGT GAG TAT AGA CAT TA

109 bp

H2: GGC TTT TGA CAG TTA ATA CA

HPV-16 E6

p1.- ATGGAACAACATTAGAACAGCAATACAACAAACCGTTGTG


Moro-Rodríguez and Álvarez-Fernández Diagnostic Pathology 2008 3:38   doi:10.1186/1746-1596-3-38

Open Data