Table 1

*Primers used for EBNA2* PCR typing**
Primers	Sequence (5'-3')	Use in the PCR reaction	EBNA-2 Location*

EBNA-2F	TGGAAACCCGTCACTCTC	1^streaction sense	48572-89
EBNA-2I	TAATGGCATAGGTGGAATG	1^streaction sntisense	49355-73
EBNA-2C	AGGGATGCCTGGACACAAGA	Nested reaction sense	48810-29
EBNA-2G	GCCTCGGTTGTGACAGAG	Nested reaction antisense type-1	49048-65
EBNA-2B	TTGAAGAGTATGTCCTAAGG	Nested reaction antisense type-2	2020-39#

* Sequence locations for type-1 correspond to B95.8 coordinates (Accession number V01555) and for type-2 (#) to AG876 isolate (Accession number K03332).
Hassan et al. Diagnostic Pathology 2006 1:17 doi:10.1186/1746-1596-1-17