Table 1

Primers used for EBNA2 PCR typing

Primers

Sequence (5'-3')

Use in the PCR reaction

EBNA-2 Location*


EBNA-2F

TGGAAACCCGTCACTCTC

1st reaction sense

48572-89

EBNA-2I

TAATGGCATAGGTGGAATG

1st reaction sntisense

49355-73

EBNA-2C

AGGGATGCCTGGACACAAGA

Nested reaction sense

48810-29

EBNA-2G

GCCTCGGTTGTGACAGAG

Nested reaction antisense type-1

49048-65

EBNA-2B

TTGAAGAGTATGTCCTAAGG

Nested reaction antisense type-2

2020-39#


* Sequence locations for type-1 correspond to B95.8 coordinates (Accession number V01555) and for type-2 (#) to AG876 isolate (Accession number K03332).

Hassan et al. Diagnostic Pathology 2006 1:17   doi:10.1186/1746-1596-1-17

Open Data